Benutzer-Werkzeuge

Webseiten-Werkzeuge


Was ist eine DNA?

Der menschliche Körper besteht aus ungefähr 100 Trilliarden Zellen. Woher weiß z. B. eine Herzzelle, dass sie eine Herzzelle ist und dementsprechend arbeiten soll?

Die Instruktionen, die alle Informationen für einen lebenden Organismus enthalten, damit dieser wachsen und funktionieren kann, liegen im Nucleus jeder Zelle, ein prozentual geringer Anteil (0,05%) der gesamten DNA befindet sich in den Mitochondrien des Zellplasmas. Diese Elemente „sagen“ jeder Zelle, welche Rolle sie zu spielen haben. Wie sehen diese Elemente aus?

Die Elemente haben die Form eines Moleküls namens DNA. DNA ist die Abkürzung für Desoxyribo Nucleic Acid (deutsche Bezeichnung: DNS - DesoxyriboNukleinSäure). Diese Moleküle kodieren für einen detaillierten Satz voller Pläne, so wie Baupläne eines Architekten, um die verschiedensten Bestandteile des Körpers bauen zu können. Wie können Moleküle Informationen speichern?

Das Molekül DNA hat die Form einer verdrehten Leiter, genannt Doppelhelix. Die Sprossen dieser Leiter bilden das DNA-Alphabet, durch welches Informationen kodiert werden. Es handelt sich also um eine Abfolge von Grundbausteinen (Nukleotiden), die sich aus einer der vier Basen Adenin, Thymin, Guanin oder Cytosin sowie einem Zuckermolekül (Desoxyribose) und einer Phosphatgruppe zusammensetzen. Die Nukleotide binden sich über Wasserstoffbrücken und folgen dabei bestimmten Regeln. A paart sich immer mit T und G immer mit C. Wie können nur 4 Basen der Zelle sagen, was sie zu tun hat?

Jeder DNA-Strang bildet also eine Reihe von Buchstaben: ATGCTCAGCTGAGAACTGCTG

Aus diesen Buchstaben bilden sich Wörter (Tripletts): ATG CTC AGC TGA GAA CTG CTG

Diese Wörter wiederum ergeben Sätze: <ATG CTC AGC> <TGA GAA CTG CTG>

Diese Sätze nennt man Gene. Gene enthalten die Informationen, um andere Moleküle (Proteine) herzustellen. Dabei kodiert jedes Triplett für je eine Aminosäure, aus welchen sich Proteine zusammensetzen. Proteine haben spezielle Funktionen, wie zum Beispiel in Herzzellen, um unseren Herzschlag zu regeln oder den Aufbau von Organen oder die Kommunikation zwischen Organen uvm..

fataxie/dna.txt · Zuletzt geändert: 2014/03/23 12:44 von Bernhard